Skip to main content

Advertisement

Table 7 Designed primer sets to differentiate biovar 4 from others

From: The draft genome of Brucella abortus strain Ba col-B012, isolated from a dairy farm in Nariño, Colombia, bring new insights into the epidemiology of biovar 4 strains

Set F. pos (bp) R. pos (bp) Forward primer Reverse primer Tm (°C)
8 281 435 AGCCACGCACGACCTATATC GCCCGAGCAATACTGATACC 60
12 478 877 GAAGCCGATCAGCAATTCAC AAAGCAGGATCGCCACATAG 60
13 178 552 GGATTGTCGTGGCTTACGAT GAAGGCATAGACCGTGGTTG 60
19 962 1218 ACGCAAGACCTTTGAAGACG GAGCGACAGCTTGATGAGG 60
30 923 1322 CGCCTTACATCAATTCCTACAA CGGTCATATTCGATCTGTTCC 59
40 22 598 ATTCTCGATCCGCATTTCAT AGAGGCCGGAGAGAATAAGC 60
  1. Position of primers is relative to the gene set alignment