Skip to main content

Advertisement

Table 5 Frequency of repeat sequences in N. lactamica Y92–1009 genome

From: Neisseria lactamica Y92–1009 complete genome sequence

Repeat type Repeat sequence Value
AT-DUS ‘ATGCCGTCTGAA’ 1718
AG-DUS ‘AGGCCGTCTGAA’ 262
AG-mucDUS ‘AGGTCGTCTGAA’ 45
DSR3 ‘ATTCCCNNNNNNNNGGGAAT’ 454
Correia ‘ATAG[CT]GGATTAACAAAAATCAGGAC’ 50
  ‘TATAG[CT]GGATTAAATTTAAACCGGTAC’ 1
  ‘TATAG[CT]GGATTAACAAAAACCGGTAC’ 17
  ‘TATAG[CT]GGATTAAATTTAAATCAGGAC’ 17