Skip to main content

Advertisement

Table 6 CRISPR-Cas loci detected in “T. syntrophicum sp. nov. strain Cad16T genome

From: Complete genome sequence of “Thiodictyon syntrophicum” sp. nov. strain Cad16T, a photolithoautotrophic purple sulfur bacterium isolated from the alpine meromictic Lake Cadagno

Localization Name CRISPR start CRISPR end CRISPR length (bp) DR consensus DR length No. of spacers CRISPR-Cas locia
chromosome CRR1CRR1 1,879,131 1,881,639 2508 GCTTCAATGAGGCCGCGGCGAATTCGCCGCGGAAAC 36 34 type I-U
  CRR2CRR2 1,883,646 1,894,325 10,679 GCTTCAATGAGGCCGCGGCGAATTCGCCGCGGAAAC 36 146
  CRR3CRR3 4,626,522 4,629,249 2727 GCATCGCCCGGCCAATTGGCCGGGCGCGGATTGAAAC 37 37 type I-C
  CRR4CRR4 5,078,034 5,085,199 7165 GTTTCCGCGGCGAATTCGCCGCGGCCTCATTGAAGC 36 98
pTs485 CRR5CRR5 391,741 393,104 1363 GTAGCGCTACTCCGAGCCGCAAAGGCTATTGAAAC 35 19
  1. a CRISPR-Cas classification according to Makarova et al. [58]